pEVOL-AcKRS-CloDF
(Plasmid
#127415)
-
PurposeMutant of mmPylRS designed for incorporation of non-canonical amino acids (acyl-lysine derivatives) in to M13 bacteriophage
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127415 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEVOL
-
Modifications to backboneReplication of origin is CloDF.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePyrrolysyl-tRNA synthetase/pyrrolysyl -tRNA pair
-
Alt namePylRS/Pyl-tRNA
-
SpeciesMethanosarcina mazei
- Promoter araBAD
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer CAATTTAGCGTTTGAAAGCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEVOL-AcKRS-CloDF was a gift from Wenshe Liu (Addgene plasmid # 127415 ; http://n2t.net/addgene:127415 ; RRID:Addgene_127415) -
For your References section:
A Genetically Encoded, Phage-Displayed Cyclic-Peptide Library. Wang XS, Chen PC, Hampton JT, Tharp JM, Reed CA, Das SK, Wang DS, Hayatshahi HS, Shen Y, Liu J, Liu WR. Angew Chem Int Ed Engl. 2019 Oct 28;58(44):15904-15909. doi: 10.1002/anie.201908713. Epub 2019 Sep 9. 10.1002/anie.201908713 PubMed 31398275