FLAG-MBP1-K295TAG-W340A-S233H-T237C.pcDNA3-k
(Plasmid #127402)

• Purpose: Expresses MBP in mammalian cells. Amber codon at AA# 295 as a noncanonical amino acid incorporation site
• Depositing Lab: Sharona Gordon
• Publication: Gordon et al Elife. 2018 Jun 20;7. pii: 37248. doi: 10.7554/eLife.37248.

Backbone

• Vector backbone: pcDNA3
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5370
• Total vector size (bp): 6651
• Modifications to backbone: Addition of Kozak Sequence
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Maltose Binding Protein
• Alt name: MBP
• Insert Size (bp): 1281
• Mutation: Amino acid mutations: K295 to Amber codon, W340A, S233H and T237C.
• Promoter: CMV
• Tag / Fusion Protein:
  • FLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Hind III (not destroyed)
• 3′ cloning site: Not I (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GACAGTGGGAGTGGCACCTT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The amino acid sequence of MBP was based on the pMAL-c5x vector (New England Biolabs) and was codon optimized for mammalian cell expression.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

W340A was introduced to reduce the affinity of MBP for endogenous ligands.