pR26-CMVconst-mBMP7
(Plasmid
#127375)
-
PurposeAllows for constitutive BMP7 expression from the murine ROSA26 safe harbor locus upon CRISPR/Cas9-mediated genomic insertion and stable selection.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127375 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCR-Blunt II-TOPO
-
Backbone manufacturerInvitrogen (Life Technologies)
- Backbone size w/o insert (bp) 7941
- Total vector size (bp) 9196
-
Modifications to backboneInserted left and right ROSA26 homology arms, adenoviral splice acceptor, MCS, and DNA sequence encoding machinery facilitating constitutive gene expression (CMV enhancer/promoter), as well as PuroR resistance gene for stable selection.
-
Vector typeMouse Targeting, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBMP7
-
Alt nameOP-1
-
SpeciesM. musculus (mouse)
-
Entrez GeneBmp7 (a.k.a. OP1)
- Promoter CMV enhancer/promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pR26-CMVconst-mBMP7 was a gift from Lance Miller (Addgene plasmid # 127375 ; http://n2t.net/addgene:127375 ; RRID:Addgene_127375) -
For your References section:
Transcriptomic Features of T Cell-Barren Tumors Are Conserved Across Diverse Tumor Types. Routh ED, Pullikuth AK, Jin G, Chifman J, Chou JW, D'Agostino RB Jr, Seino KI, Wada H, Print CG, Zhang W, Lu Y, Miller LD. Front Immunol. 2020 Feb 13;11:57. doi: 10.3389/fimmu.2020.00057. eCollection 2020. 10.3389/fimmu.2020.00057 PubMed 32117236