-
PurposeExpresses BFP constitutively via the CAGGS promoter in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127348 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAGGs
-
Backbone manufacturerAllan Gurtan (Phil Sharp Lab)
- Total vector size (bp) 5447
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBlue Fluorescent Protein
-
Alt nameBFP
-
SpeciesSynthetic
-
Insert Size (bp)720
- Promoter CAGGS Promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
- 3′ sequencing primer CCCATATGTCCTTCCGAGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGs-BFP was a gift from Phil Sharp (Addgene plasmid # 127348 ; http://n2t.net/addgene:127348 ; RRID:Addgene_127348)