Cdk13_intron4_sg3_pX330
(Plasmid
#127340)
-
PurposesgRNA that cuts within intron 4 of mouse CDK13 genomic locus- guide #3
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127340 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX330
-
Backbone manufacturerFeng Zhang Lab (Addgene Plasmid #42230)
- Backbone size w/o insert (bp) 8484
- Total vector size (bp) 8487
-
Vector typeMouse Targeting, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMouse Cdk13 Intron 4 Targeting sgRNA
-
Alt nameCdk13
-
gRNA/shRNA sequenceTGTATCACCAGCCCTCAAGA
-
SpeciesM. musculus (mouse)
-
Entrez GeneCdk13 (a.k.a. 2310015O17Rik, Cdc2l5)
- Promoter U6 Promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer LKO.1 5' primer (gactatcatatgcttaccgt) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/824193 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cdk13_intron4_sg3_pX330 was a gift from Phil Sharp (Addgene plasmid # 127340 ; http://n2t.net/addgene:127340 ; RRID:Addgene_127340) -
For your References section:
Oncogenic CDK13 mutations impede nuclear RNA surveillance. Insco ML, Abraham BJ, Dubbury SJ, Kaltheuner IH, Dust S, Wu C, Chen KY, Liu D, Bellaousov S, Cox AM, Martin BJE, Zhang T, Ludwig CG, Fabo T, Modhurima R, Esgdaille DE, Henriques T, Brown KM, Chanock SJ, Geyer M, Adelman K, Sharp PA, Young RA, Boutz PL, Zon LI. Science. 2023 Apr 21;380(6642):eabn7625. doi: 10.1126/science.abn7625. Epub 2023 Apr 21. 10.1126/science.abn7625 PubMed 37079685