Skip to main content
Addgene

pcDNA3.1(+)/AUG-DAP5-3XFLAG
(Plasmid #127331)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127331 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1(+)
  • Total vector size (bp) 8221
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DAP5
  • Species
    H. sapiens (human)
  • Entrez Gene
    EIF4G2 (a.k.a. AAG1, DAP5, NAT1, P97)
  • Promoter CMV
  • Tag / Fusion Protein
    • 3xFLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains a 23 nucleotide deletion in the backbone compared to the depositor sequence, which does not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1(+)/AUG-DAP5-3XFLAG was a gift from Jeremy Wilusz (Addgene plasmid # 127331 ; http://n2t.net/addgene:127331 ; RRID:Addgene_127331)
  • For your References section:

    Ribosome queuing enables non-AUG translation to be resistant to multiple protein synthesis inhibitors. Kearse MG, Goldman DH, Choi J, Nwaezeapu C, Liang D, Green KM, Goldstrohm AC, Todd PK, Green R, Wilusz JE. Genes Dev. 2019 Jun 6. pii: gad.324715.119. doi: 10.1101/gad.324715.119. 10.1101/gad.324715.119 PubMed 31171704