Skip to main content
Addgene

pAAV-hSyn-ChRger3-TS-EYFP
(Plasmid #127240)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127240 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4559
  • Total vector size (bp) 6428
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Use Rec A- competent cells such as Stbl3 cells from Invitrogen for transformation.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ChRger3-TS-EYFP
  • Insert Size (bp)
    1869
  • Promoter hSyn1
  • Tags / Fusion Proteins
    • EYFP (C terminal on insert)
    • SpyTag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gaggcgcgagataggggg
  • 3′ sequencing primer atatcgaattcttattacttgtacagctcgtccatgcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-ChRger3-TS-EYFP was a gift from Viviana Gradinaru (Addgene plasmid # 127240 ; http://n2t.net/addgene:127240 ; RRID:Addgene_127240)
  • For your References section:

    Machine learning-guided channelrhodopsin engineering enables minimally invasive optogenetics. Bedbrook CN, Yang KK, Robinson JE, Mackey ED, Gradinaru V, Arnold FH. Nat Methods. 2019 Oct 14. pii: 10.1038/s41592-019-0583-8. doi: 10.1038/s41592-019-0583-8. 10.1038/s41592-019-0583-8 PubMed 31611694