pAAV-CAG-DIO(ChRger2-TS-YFP)
(Plasmid #127239)

• Purpose: High photocurrent, low-light sensitive channelrhodopsin (ChRger2) for optogenetic activation with systemic delivery or for low-light activation. Driven by the CAG promoter and double floxed.
• Depositing Lab: Viviana Gradinaru
• Publication: Bedbrook et al Nat Methods. 2019 Oct 14. pii: 10.1038/s41592-019-0583-8. doi: 10.1038/s41592-019-0583-8.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 5457
• Total vector size (bp): 7311
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Use Rec A- competent cells such as Stbl3 cells from Invitrogen for transformation.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ChRger2-TS-EYFP
• Insert Size (bp): 1854
• Promoter: CAG
• Tags / Fusion Proteins:
  • EYFP (C terminal on insert)
  • SpyTag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: GCTGTAATTAGCGCTTGGTTTAATGAC
• 3′ sequencing primer: gccacaactcctcataaagagacag

Resource Information

• Supplemental Documents:
  • pAAV-CAG-DIO(ChRger2_TS_YFP)-WPRE-pA.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry