pAAV-CaMKIIa-ChRger2-TS-EYFP
(Plasmid
#127238)
-
PurposeHigh photocurrent, low-light sensitive channelrhodopsin (ChRger2) for optogenetic activation with systemic delivery or for low-light activation. Driven by the CamKIIa promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127238 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5076
- Total vector size (bp) 6930
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsPlease use Rec A- competent cells such as Stbl3 cells from Invitrogen for transformation.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChRger2-TS-EYFP
-
Insert Size (bp)1854
- Promoter CamKIIa
-
Tags
/ Fusion Proteins
- EYFP (C terminal on insert)
- SpyTag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer cgggggatccgccaccATG
- 3′ sequencing primer atatcgaattcttattacttgtacagctcgtccatgcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CaMKIIa-ChRger2-TS-EYFP was a gift from Viviana Gradinaru (Addgene plasmid # 127238 ; http://n2t.net/addgene:127238 ; RRID:Addgene_127238) -
For your References section:
Machine learning-guided channelrhodopsin engineering enables minimally invasive optogenetics. Bedbrook CN, Yang KK, Robinson JE, Mackey ED, Gradinaru V, Arnold FH. Nat Methods. 2019 Oct 14. pii: 10.1038/s41592-019-0583-8. doi: 10.1038/s41592-019-0583-8. 10.1038/s41592-019-0583-8 PubMed 31611694