Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPTG-GG-sg2+sg3
(Plasmid #127199)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127199 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBR322
  • Backbone size w/o insert (bp) 2300
  • Total vector size (bp) 3230
  • Vector type
    Mammalian Expression ; Empty sgRNA plasmid

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    tRNA-gRNA
  • gRNA/shRNA sequence
    TACCACATTTGTAGAGGTT & CAATGTATCTTATCATGTC
  • Species
    Synthetic; Mammalian expression
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CAGGGTTATTGTCTCATGAGCGGA
  • 3′ sequencing primer CAATGTATCTTATCATGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPTG-GG-sg2+sg3 was a gift from Jordan Green (Addgene plasmid # 127199 ; http://n2t.net/addgene:127199 ; RRID:Addgene_127199)
  • For your References section:

    Poly(Beta-Amino Ester) Nanoparticles Enable Nonviral Delivery of CRISPR-Cas9 Plasmids for Gene Knockout and Gene Deletion. Rui Y, Varanasi M, Mendes S, Yamagata HM, Wilson DR, Green JJ. Mol Ther Nucleic Acids. 2020 Apr 21;20:661-672. doi: 10.1016/j.omtn.2020.04.005. 10.1016/j.omtn.2020.04.005 PubMed 32380416