Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PB-GFP-Gal8
(Plasmid #127191)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127191 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PB-CAG-GAPd2
  • Backbone size w/o insert (bp) 6466
  • Total vector size (bp) 7422
  • Modifications to backbone
    In-frame insertion of Gal8 to form c-terminus fusion protein with GFP
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP-Gal8
  • Alt name
    Galectin-8
  • Alt name
    GFP
  • Alt name
    LGALS8
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2135
  • GenBank ID
    3964
  • Entrez Gene
    LGALS8 (a.k.a. Gal-8, PCTA-1, PCTA1, Po66-CBP)
  • Promoter CMV
  • Tag / Fusion Protein
    • Gal8 is fused to the c-terminus of GFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsrGI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer AAGATCTCAGTGGTATTTGTGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-GFP-Gal8 was a gift from Jordan Green (Addgene plasmid # 127191 ; http://n2t.net/addgene:127191 ; RRID:Addgene_127191)
  • For your References section:

    Carboxylated branched poly(beta-amino ester) nanoparticles enable robust cytosolic protein delivery and CRISPR-Cas9 gene editing. Rui Y, Wilson DR, Choi J, Varanasi M, Sanders K, Karlsson J, Lim M, Green JJ. Sci Adv. 2019 Dec 6;5(12):eaay3255. doi: 10.1126/sciadv.aay3255. eCollection 2019 Dec. 10.1126/sciadv.aay3255 PubMed 31840076