PB-Neo-TetO-Cdk12_Nterm_FlagHa
(Plasmid
#127179)
-
PurposeN-terminal Flag- HA- tandem epitope tagged mouse Cdk12 transgene (NM_001109626.1 isoform) cloned into a dox-inducible piggybac destination vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127179 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePBNeo-TetO-Dest
-
Backbone manufacturerAlbert Cheng (Jackson Labs)
- Backbone size w/o insert (bp) 10369
- Total vector size (bp) 13274
-
Modifications to backboneNone
-
Vector typeMammalian Expression ; Piggybac Transposase Vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameN-terminally Flag- HA- Epitope Tagged Mouse Cyclin Dependent Kinase 12
-
Alt nameCdk12
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)4533
-
GenBank IDNM_001109626.1
-
Entrez GeneCdk12 (a.k.a. 1810022J16Rik, Crk7, Crkrs, D11Ertd752e, Pksc)
- Promoter TetO Promoter
-
Tag
/ Fusion Protein
- Flag- HA- Tandem Epitopes (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer atccacgctgttttgacctc
- 3′ sequencing primer agaccgaggagagggttagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-Neo-TetO-Cdk12_Nterm_FlagHa was a gift from Phil Sharp (Addgene plasmid # 127179 ; http://n2t.net/addgene:127179 ; RRID:Addgene_127179) -
For your References section:
CDK12 regulates DNA repair genes by suppressing intronic polyadenylation. Dubbury SJ, Boutz PL, Sharp PA. Nature. 2018 Dec;564(7734):141-145. doi: 10.1038/s41586-018-0758-y. Epub 2018 Nov 28. 10.1038/s41586-018-0758-y PubMed 30487607