Cdk12_intron4_sg1_pX458
(Plasmid
#127175)
-
PurposesgRNA that cuts within intron 4 of mouse CDK12 genomic locus in pX458 backbone
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127175 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX458
-
Backbone manufacturerFeng Zhang Lab (Addgene Plasmid #48138)
- Backbone size w/o insert (bp) 9288
- Total vector size (bp) 9291
-
Modifications to backbonegRNA sequence provided cloned into pX458 using modified version of protocol published in https://www.nature.com/articles/nprot.2013.143
-
Vector typeMouse Targeting, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMouse Cdk12 Intron 4 sgRNA
-
gRNA/shRNA sequenceAAGAGCTCTCTGGTCATGCG
-
SpeciesM. musculus (mouse)
- Promoter U6 Promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer LKO.1 5' primer (gactatcatatgcttaccgt) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cdk12_intron4_sg1_pX458 was a gift from Phil Sharp (Addgene plasmid # 127175 ; http://n2t.net/addgene:127175 ; RRID:Addgene_127175) -
For your References section:
CDK12 regulates DNA repair genes by suppressing intronic polyadenylation. Dubbury SJ, Boutz PL, Sharp PA. Nature. 2018 Dec;564(7734):141-145. doi: 10.1038/s41586-018-0758-y. Epub 2018 Nov 28. 10.1038/s41586-018-0758-y PubMed 30487607