-
Purpose(Empty Backbone) Entry plasmid for guide cloning
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127173 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepLenti (Addgene #86708)
-
Vector typeMammalian Expression, Lentiviral, CRISPR
- Promoter EF1a
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- 5′ sequencing primer tcttgtggaaaggacgaaaca
- 3′ sequencing primer aagcaccgactcggtgccac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cloning Method: Golden Gate; 3' Cloning Site: aagcaccgactcggtgccac
Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CROPseq-Guide-Zeo was a gift from Paul Blainey (Addgene plasmid # 127173 ; http://n2t.net/addgene:127173 ; RRID:Addgene_127173) -
For your References section:
Optical Pooled Screens in Human Cells. Feldman D, Singh A, Schmid-Burgk JL, Carlson RJ, Mezger A, Garrity AJ, Zhang F, Blainey PC. Cell. 2019 Oct 17;179(3):787-799.e17. doi: 10.1016/j.cell.2019.09.016. 10.1016/j.cell.2019.09.016 PubMed 31626775
