RFP-(SUMO)3
(Plasmid #127150)

• Purpose: Mammalian expression plasmid for mCherry-(SUMO)3 client to assess SUMO-SIM scaffolds.
• Depositing Lab: Michael Rosen
• Publication: Banani et al Cell. 2016 Jul 28;166(3):651-663. doi: 10.1016/j.cell.2016.06.010. Epub 2016 Jun 30.

Backbone

• Vector backbone: pC1-mCherry
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4722
• Total vector size (bp): 5694
• Modifications to backbone: unknown
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 3 copies of human SUMO1 separated by (GGS)4
• Species: H. sapiens (human)
• Insert Size (bp): 1005
• Entrez Gene: SUMO3 (a.k.a. SMT3A, SMT3H1, SUMO-3, Smt3B)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BspEI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: CCCCGTAATGCAGAAGAAGA
• 3′ sequencing primer: TGTGGGAGGTTTTTTAAAGCAAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry