Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

px458_2A_GFP_sgRNA_ZNF598
(Plasmid #127121)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127121 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    px458_2A_GFP_sgRNA
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA ZNF598
  • gRNA/shRNA sequence
    ACCGCTGCTCTACCAAGATG
  • Species
    H. sapiens (human)
  • Entrez Gene
    ZNF598 (a.k.a. HEL2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    px458_2A_GFP_sgRNA_ZNF598 was a gift from Thomas Tuschl (Addgene plasmid # 127121 ; http://n2t.net/addgene:127121 ; RRID:Addgene_127121)
  • For your References section:

    The G3BP1-Family-USP10 Deubiquitinase Complex Rescues Ubiquitinated 40S Subunits of Ribosomes Stalled in Translation from Lysosomal Degradation. Meyer C, Garzia A, Morozov P, Molina H, Tuschl T. Mol Cell. 2020 Mar 19;77(6):1193-1205.e5. doi: 10.1016/j.molcel.2019.12.024. Epub 2020 Jan 24. 10.1016/j.molcel.2019.12.024 PubMed 31981475