px458_2A_GFP_sgRNA_G3BP1_G1
(Plasmid
#127114)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127114 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepx458_2A_GFP_sgRNA
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA G3BP1
-
gRNA/shRNA sequencetagtcccctgctggtcgggc
-
SpeciesH. sapiens (human)
-
Entrez GeneG3BP1 (a.k.a. G3BP, HDH-VIII)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px458_2A_GFP_sgRNA_G3BP1_G1 was a gift from Thomas Tuschl (Addgene plasmid # 127114 ; http://n2t.net/addgene:127114 ; RRID:Addgene_127114)