pCfB8622
(Plasmid
#126912)
-
PurposePlasmid containing gRNA expression cassette targeting ADE2 in Saccharomyces cerevisiae
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126912 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTAJAK-71
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameADE2 gRNA
-
gRNA/shRNA sequenceAATTGTAGAGACTATCCACA
-
SpeciesS. cerevisiae (budding yeast)
Cloning Information
- Cloning method Unknown
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCfB8622 was a gift from Irina Borodina (Addgene plasmid # 126912 ; http://n2t.net/addgene:126912 ; RRID:Addgene_126912) -
For your References section:
A teaching protocol demonstrating the use of EasyClone and CRISPR/Cas9 for metabolic engineering of Saccharomyces cerevisiae and Yarrowia lipolytica. Milne N, Tramontin LRR, Borodina I. FEMS Yeast Res. 2019 Sep 26. pii: foz062. doi: 10.1093/femsyr/foz062. 10.1093/femsyr/foz062 PubMed 31556952