pCfB5191
(Plasmid
#126911)
-
PurposePlasmid containing gRNA expression cassettes targeting the X-4 and XII-5 integration sites in Saccharomyces cerevisiae
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 126911 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepTAJAK-71
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameX-4 and XII-5 gRNA
-
gRNA/shRNA sequencecgccattcaagagcagcaac and ttgtcacagtgtcacatcag
-
SpeciesS. cerevisiae (budding yeast)
Cloning Information
- Cloning method Unknown
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCfB5191 was a gift from Irina Borodina (Addgene plasmid # 126911 ; http://n2t.net/addgene:126911 ; RRID:Addgene_126911) -
For your References section:
A teaching protocol demonstrating the use of EasyClone and CRISPR/Cas9 for metabolic engineering of Saccharomyces cerevisiae and Yarrowia lipolytica. Milne N, Tramontin LRR, Borodina I. FEMS Yeast Res. 2019 Sep 26. pii: foz062. doi: 10.1093/femsyr/foz062. 10.1093/femsyr/foz062 PubMed 31556952
