Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCfB5191
(Plasmid #126911)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 126911 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTAJAK-71
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    X-4 and XII-5 gRNA
  • gRNA/shRNA sequence
    cgccattcaagagcagcaac and ttgtcacagtgtcacatcag
  • Species
    S. cerevisiae (budding yeast)

Cloning Information

  • Cloning method Unknown

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCfB5191 was a gift from Irina Borodina (Addgene plasmid # 126911 ; http://n2t.net/addgene:126911 ; RRID:Addgene_126911)
  • For your References section:

    A teaching protocol demonstrating the use of EasyClone and CRISPR/Cas9 for metabolic engineering of Saccharomyces cerevisiae and Yarrowia lipolytica. Milne N, Tramontin LRR, Borodina I. FEMS Yeast Res. 2019 Sep 26. pii: foz062. doi: 10.1093/femsyr/foz062. 10.1093/femsyr/foz062 PubMed 31556952