Skip to main content
Addgene

pRSFDuet1-Cdc45 (delta 154–164)
(Plasmid #126879)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 126879 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pRSFDuet-1
  • Backbone size w/o insert (bp) 3766
  • Total vector size (bp) 5443
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human Cdc45
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1677
  • Mutation
    deletion amino acid 154-164
  • Entrez Gene
    CDC45 (a.k.a. CDC45L, CDC45L2, MGORS7, PORC-PI-1)
  • Promoter T7 promoter
  • Tag / Fusion Protein
    • No tag

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TTGTACACGGCCGCATAATC
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This clone was already present before I joined the lab. But I have fully sequenced it to confirm.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSFDuet1-Cdc45 (delta 154–164) was a gift from Luca Pellegrini (Addgene plasmid # 126879 ; http://n2t.net/addgene:126879 ; RRID:Addgene_126879)

  • For your References section:

    Structure of human Cdc45 and implications for CMG helicase function. Simon AC, Sannino V, Costanzo V, Pellegrini L. Nat Commun. 2016 May 18;7:11638. doi: 10.1038/ncomms11638. 10.1038/ncomms11638 PubMed 27189187
Related items: