pX330-Flag-Sniper SpCas9 (without sgRNA; with silent mutations)
(Plasmid #126777)

• Purpose: Expression plasmid for human codon-optimized increased fidelity Sniper SpCas9 (without U6-sgRNA coding sequence, with silent mutations)
• Depositing Lab: Ervin Welker
• Publication: Kulcsar et al Nat Commun. 2020 Mar 6;11(1):1223. doi: 10.1038/s41467-020-15021-5.

Backbone

• Vector backbone: pX330-like (without U6-sgRNA coding sequence)
• Total vector size (bp): 8077
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Sniper SpCas9
• Species: S. pyogenes
• Insert Size (bp): 4272
• Mutation: F539S, M763I, K890N
• Promoter: CBh
• Tags / Fusion Proteins:
  • 3xFLAG (N terminal on insert)
  • NLS (N terminal on insert)
  • NLS (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GGAAGCAGCGGACCTTCGAC
• 3′ sequencing primer: CACGACGGCGTTCAGGTACGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pCbh-3xFLAG-NLS-Sniper SpCas9-NLS (without U6-sgRNA coding sequence, with silent mutations).

The lack of sgRNA expression cassette allows for easy testing of various SpCas9 variants with the same sgRNA expressed from a separate plasmid (e.g. pmCherry_gRNA, Addgene# #80457).

For detailed information and plasmid usage, please see the associated publication.