pET-FLAG-SpCas9-HF1-plus
(Plasmid #126775)

• Purpose: Expression of increased fidelity SpCas9-HF1-plus in bacterial cells. Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with close to the same fidelity as SpCas9-HF1.
• Depositing Lab: Ervin Welker
• Publication: Kulcsar et al Nat Commun. 2020 Mar 6;11(1):1223. doi: 10.1038/s41467-020-15021-5.

Backbone

• Vector backbone: pMJ806-like
• Total vector size (bp): 10734
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SpCas9-HF1-plus
• Alt name: Blackjack-SpCas9-HF1-plus
• Species: S. pyogenes
• Insert Size (bp): 5436
• Mutation: N497A; Q695A; Q926A; amino acids 1005-1013 replaced with two glycine
• Promoter: T7
• Tags / Fusion Proteins:
  • 3xFLAG (N terminal on insert)
  • NLS (N terminal on insert)
  • NLS (C terminal on insert)
  • MBP (N terminal on backbone)
  • 6xHis (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BcuI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CGGCGTACTGGTCGCCGATC
• 3′ sequencing primer: TGCTAGTTATTGCTCAGCGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pET-T7-6xHis-MBP-TEV-FLAG-NLS-SpCas9-HF1-plus-NLS

SpCas9-HF1-plus cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs. Shows almost the same fidelity and target selectivity as its parental increased fidelity variant, SpCas9-HF1.

For detailed information and plasmid usage, please see the associated publication.