pET-FLAG-eSpCas9-plus
(Plasmid #126774)

• Purpose: Expression of increased fidelity eSpCas9-plus in bacterial cells. Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with close to the same fidelity as eSpCas9.
• Depositing Lab: Ervin Welker
• Publication: Kulcsar et al Nat Commun. 2020 Mar 6;11(1):1223. doi: 10.1038/s41467-020-15021-5.

Backbone

• Vector backbone: pMJ806-like
• Total vector size (bp): 10734
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: eSpCas9-plus
• Alt name: Blackjack-eSpCas9-plus
• Species: S. pyogenes
• Insert Size (bp): 5436
• Mutation: K848A, R1060A; amino acids 1005-1013 replaced with two glycine
• Promoter: T7
• Tags / Fusion Proteins:
  • 3xFLAG (N terminal on insert)
  • NLS (N terminal on insert)
  • NLS (C terminal on insert)
  • MBP (N terminal on backbone)
  • 6xHis (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BcuI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CGGCGTACTGGTCGCCGATC
• 3′ sequencing primer: TGCTAGTTATTGCTCAGCGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pET-T7-6xHis-MBP-TEV-FLAG-NLS-eSpCas9-plus-NLS

eSpCas9-plus cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs. Shows almost the same fidelity and target selectivity as its parental increased fidelity variant, eSpCas9.

For detailed information and plasmid usage, please see the associated publication.