pU6-SCGB3A2_gRNA1-SpCas9-T2A-GFP
(Plasmid
#126698)
-
Purposeto express Cas9 from S. pyogenes with 2A-EGFP and sgRNA targeting human SCGB3A2 locus at the end of the endogenous coding sequence
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126698 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePX458
-
Backbone manufacturerMorrissey Laboratory
- Backbone size w/o insert (bp) 9186
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting human SCGB3A2 locus
-
gRNA/shRNA sequencecaccgtcaggaggcgctatcacactgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc
-
Insert Size (bp)76
- Promoter Human U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byMorrissey Laboratory
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-SCGB3A2_gRNA1-SpCas9-T2A-GFP was a gift from Darrell Kotton (Addgene plasmid # 126698 ; http://n2t.net/addgene:126698 ; RRID:Addgene_126698) -
For your References section:
Single-Cell Transcriptomic Profiling of Pluripotent Stem Cell-Derived SCGB3A2+ Airway Epithelium. McCauley KB, Alysandratos KD, Jacob A, Hawkins F, Caballero IS, Vedaie M, Yang W, Slovik KJ, Morley M, Carraro G, Kook S, Guttentag SH, Stripp BR, Morrisey EE, Kotton DN. Stem Cell Reports. 2018 May 8;10(5):1579-1595. doi: 10.1016/j.stemcr.2018.03.013. Epub 2018 Apr 12. 10.1016/j.stemcr.2018.03.013 PubMed 29657097