pHAGE-EF1aL-nlsGFP-W
(Plasmid #126688)

• Purpose: Constitutive, ubiquitous, nuclear-localized GFP expression.
• Depositing Lab: Darrell Kotton
• Publication: Tang et al Nat. Phys. 18, 1371–1378 (2022).

Backbone

• Vector backbone: pHAGE
• Backbone manufacturer: Derived in Kotton lab
• Backbone size w/o insert (bp): 6978
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: nlsGFP
• Species: A. Victoria (Jellyfish), Human promoter
• Insert Size (bp): 763
• Promoter: EF1aL
• Tags / Fusion Proteins:
  • NLS (N terminal on insert)
  • 6xHIS (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ccattatcgtttcagacccacctcc
• 3′ sequencing primer: TCGCCCTCGAACTTCACCTCG

Resource Information

• Supplemental Documents:
  • pHAGE-EF1aL-nlsGFP-W.gb
• A portion of this plasmid was derived from a plasmid made by: Balazs Laboratory

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry