pGEX Shark-tSH2
(Plasmid
#126672)
-
PurposeExpression of Shark tandem SH2 domains SNAP tagged for use as FRET reporter
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 126672 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepGEX
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameShark tandem SH2 domains
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX Shark-tSH2 was a gift from Ron Vale (Addgene plasmid # 126672 ; http://n2t.net/addgene:126672 ; RRID:Addgene_126672) -
For your References section:
Spatial control of Draper receptor signaling initiates apoptotic cell engulfment. Williamson AP, Vale RD. J Cell Biol. 2018 Nov 5;217(11):3977-3992. doi: 10.1083/jcb.201711175. Epub 2018 Aug 23. 10.1083/jcb.201711175 PubMed 30139739
Map uploaded by the depositor.
