pWJB9
(Plasmid
#126650)
-
PurposeExpresses AdrA from a modified pLAFR3
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126650 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBAD30
-
Backbone manufacturerGuzman et al, J Bacteriol, 1995, 177(14):4121-30
- Backbone size w/o insert (bp) 4919
- Total vector size (bp) 6070
-
Vector typeBacterial Expression
-
Selectable markersNalidixic acid resistance
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsoptional other temperatures
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameadrA-8xHis/AdrA-8xHis including flanking promoter regions from pBAD30
-
Alt nameyaiC
-
SpeciesSalmonella typhimurium ATCC14028 Nal resistant
-
Insert Size (bp)1151
-
GenBank IDEMBL:ACY86975.1
- Promoter PBAD
-
Tag
/ Fusion Protein
- 8xHis (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer cloning primer: ACCCTGCAGGACGAAGCAGGGATTCTGCA
- 3′ sequencing primer cloning primer: ACCCTGCAGCCAGCGTTTCTGGGTGAGCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWJB9 was a gift from Ute Romling (Addgene plasmid # 126650 ; http://n2t.net/addgene:126650 ; RRID:Addgene_126650) -
For your References section:
GGDEF and EAL domains inversely regulate cyclic di-GMP levels and transition from sessility to motility. Simm R, Morr M, Kader A, Nimtz M, Romling U. Mol Microbiol. 2004 Aug;53(4):1123-34. doi: 10.1111/j.1365-2958.2004.04206.x. 10.1111/j.1365-2958.2004.04206.x PubMed 15306016