pB-puro-V5-Trpt1
(Plasmid
#126607)
-
PurposeExpresses N-terminal V5-tagged mouse Trpt1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126607 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePB-puro
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nametRNA 2' phosphotransferase 1
-
Alt nameTrpt1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)750
-
Entrez GeneTrpt1 (a.k.a. AU079016, AW045591, Tpt1, Tpt1h)
- Promoter CAG
-
Tag
/ Fusion Protein
- V5 (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer GAGCCTCTGCTAACCATGTTCATGCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pB-puro-V5-Trpt1 was a gift from Xiaozhong Wang (Addgene plasmid # 126607 ; http://n2t.net/addgene:126607 ; RRID:Addgene_126607) -
For your References section:
The cyclic phosphodiesterase CNP and RNA cyclase RtcA fine-tune noncanonical XBP1 splicing during ER stress. Unlu I, Lu Y, Wang X. J Biol Chem. 2018 Dec 14;293(50):19365-19376. doi: 10.1074/jbc.RA118.004872. Epub 2018 Oct 24. 10.1074/jbc.RA118.004872 PubMed 30355738