Skip to main content
Addgene

NLS-HA-2xMCP-Ezh2
(Plasmid #126590)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 126590 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pHAGE-UbiC
  • Total vector size (bp) 9323
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    2XMCP-Ezh2
  • Alt name
    2x MS2 coat protein
  • Alt name
    mouse Ezh2 (Enx-1, Enx1h, KMT6, mKIAA4065)
  • Species
    M. musculus (mouse), Synthetic
  • Entrez Gene
    Ezh2 (a.k.a. Enx-1, Enx1h, KMT6, mKIAA4065)
  • Promoter human ubiquitin C promoter
  • Tag / Fusion Protein
    • NLS-HA (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer hUBCpro-F2 CGCCGATGATTATATAAGGA
  • 3′ sequencing primer mTagBFP-R
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    NLS-HA-2xMCP-Ezh2 was a gift from David Segal (Addgene plasmid # 126590 ; http://n2t.net/addgene:126590 ; RRID:Addgene_126590)

  • For your References section:

    Ezh2-dCas9 and KRAB-dCas9 enable engineering of epigenetic memory in a context-dependent manner. O'Geen H, Bates SL, Carter SS, Nisson KA, Halmai J, Fink KD, Rhie SK, Farnham PJ, Segal DJ. Epigenetics Chromatin. 2019 May 3;12(1):26. doi: 10.1186/s13072-019-0275-8. 10.1186/s13072-019-0275-8 PubMed 31053162
Related items:
Commonly requested with: