-
PurposeA CRISPR/Cas9 construct to target the AAVS1 locus in humans
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126582 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSpCas9(BB)-2A-GFP (PX458)
-
Backbone manufacturerFeng Zhang (Addgene plasmid # 48138
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAAVS1 sgRNA
-
gRNA/shRNA sequenceGGGGCCACTAGGGACAGGAT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bbs1 (unknown if destroyed)
- 3′ cloning site Bbs1 (unknown if destroyed)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/585927v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMGS7 (AAVS1sgRNA) was a gift from Michael Guertin (Addgene plasmid # 126582 ; http://n2t.net/addgene:126582 ; RRID:Addgene_126582) -
For your References section:
An improved auxin-inducible degron system preserves native protein levels and enables rapid and specific protein depletion. Sathyan KM, McKenna BD, Anderson WD, Duarte FM, Core L, Guertin MJ. Genes Dev. 2019 Oct 1;33(19-20):1441-1455. doi: 10.1101/gad.328237.119. Epub 2019 Aug 29. 10.1101/gad.328237.119 PubMed 31467088