Skip to main content
Addgene

pEcoCascade-IL1RNcrRNA
(Plasmid #126481)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 126481 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA
  • Total vector size (bp) 3220
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Eco IL1RN cr26
  • gRNA/shRNA sequence
    GAGGGGCAGCTCCACCCTGGGAGGGACTGT
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEcoCascade-IL1RNcrRNA was a gift from Charles Gersbach (Addgene plasmid # 126481 ; http://n2t.net/addgene:126481 ; RRID:Addgene_126481)
  • For your References section:

    Targeted transcriptional modulation with type I CRISPR-Cas systems in human cells. Pickar-Oliver A, Black JB, Lewis MM, Mutchnick KJ, Klann TS, Gilcrest KA, Sitton MJ, Nelson CE, Barrera A, Bartelt LC, Reddy TE, Beisel CL, Barrangou R, Gersbach CA. Nat Biotechnol. 2019 Sep 23. pii: 10.1038/s41587-019-0235-7. doi: 10.1038/s41587-019-0235-7. 10.1038/s41587-019-0235-7 PubMed 31548729