pDmelOR-mRho.V5.mER.hOr56a
(Plasmid #126479)

• Purpose: Human codon-optimized D. melanogaster Orco (hOrco) and Or56a (hOr56a). Or56a has N-terminal tags derived from human Rhodopsin (mRho) and HCN1 (mER) for improved trafficking in mammalian cells
• Depositing Lab: Bill Hansson
• Publication: Miazzi et al Chem Senses. 2019 Oct 26;44(9):673-682. doi: 10.1093/chemse/bjz062.

Backbone

• Vector backbone: pCMV-BI
• Backbone size w/o insert (bp): 4111
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Or56a
• Alt name: DmelOr56a
• Alt name: Odorant receptor 56a
• Species: D. melanogaster (fly)
• Insert Size (bp): 1338
• Mutation: codon optimization for H. sapiens
• Entrez Gene: Or56a (a.k.a. Dmel_CG12501, 56E.1, 56a, CG12501, DOR59, DmOr56a, Dmel\CG12501, OR56a)
• Promoter: CMV
• Tags / Fusion Proteins:
  • H. sapiens Rhodopsin 344QVAPA348 (mRho) (N terminal on insert)
  • V5 tag (N terminal on insert)
  • H. sapiens HCN1 106VNKFSL111 (mER) (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (destroyed during cloning)
• 3′ cloning site: EcoRI (destroyed during cloning)
• 5′ sequencing primer: CATTTTATGTTTCAGGTTCAGGGGG
• 3′ sequencing primer: GGCCTATATAAGCAGAGCTCGTTT

Gene/Insert 2

• Gene/Insert name: Orco
• Alt name: DmelOrco
• Alt name: Olfactory receptor co-receptor
• Species: D. melanogaster (fly)
• Insert Size (bp): 1509
• Mutation: codon optimization for H. sapiens; including a recombinant β-globin/IgG chimeric intron
• Entrez Gene: Orco (a.k.a. Dmel_CG10609, 83A.2, 83b, A45, CG10609, DOR45, DOR83b, DmORCO, DmOrco, DmelOrco, Dmel\CG10609, OR49, OR83B, OR83b, ORCO, Or83b, OrCo, or83b, orco, vainsA)
• Promoter: CMV
• Tag / Fusion Protein:
  • Myc (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: GTGTACGGTGGGAGGTCTATATAAG
• 3′ sequencing primer: GTGGTATGGCTGATTATGATCCTCT

Resource Information

• Supplemental Documents:
  • pDmelOR-mRho.V5.mER.hOr56a
  • mRho.V5.mER.hOr56a (in pDmelOR)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Is it recommended to digest the vector with XhoI and NaeI and gel purify the two bands before sequencing as the two CMV promoters and SV40-polyA sequences are very similar to each other Please visit https://www.biorxiv.org/content/10.1101/669127v1 for BioRxiv preprint