pDmelOR-mRho.V5.mER.hOr47a
(Plasmid
#126478)
-
PurposeHuman codon-optimized D. melanogaster Orco (hOrco) and Or47a (hOr47a). Or47a has N-terminal tags derived from human Rhodopsin (mRho) and HCN1 (mER) for improved trafficking in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126478 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV-BI
- Backbone size w/o insert (bp) 4111
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameOr47a
-
Alt nameDmelOr47a
-
Alt nameOdorant receptor 47a
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)1251
-
Mutationcodon optimization for H. sapiens
-
Entrez GeneOr47a (a.k.a. Dmel_CG13225, 47E.1, 47a, AN10, CG13225, DOR24, DOR47E.1, Dmel\CG13225, OR47a, Or24, Or47E.1, dor24, or47a)
- Promoter CMV
-
Tags
/ Fusion Proteins
- H. sapiens Rhodopsin 344QVAPA348 (mRho) (N terminal on insert)
- V5 tag (N terminal on insert)
- H. sapiens HCN1 106VNKFSL111 (mER) (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (destroyed during cloning)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer CATTTTATGTTTCAGGTTCAGGGGG
- 3′ sequencing primer GGCCTATATAAGCAGAGCTCGTTT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameOrco
-
Alt nameDmelOrco
-
Alt nameOlfactory receptor co-receptor
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)1509
-
Mutationcodon optimization for H. sapiens; including a recombinant β-globin/IgG chimeric intron
-
Entrez GeneOrco (a.k.a. Dmel_CG10609, 83A.2, 83b, A45, CG10609, DOR45, DOR83b, DmORCO, DmOrco, DmelOrco, Dmel\CG10609, OR49, OR83B, OR83b, ORCO, Or83b, OrCo, or83b, orco, vainsA)
- Promoter CMV
-
Tag
/ Fusion Protein
- Myc (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GTGTACGGTGGGAGGTCTATATAAG
- 3′ sequencing primer GTGGTATGGCTGATTATGATCCTCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Is it recommended to digest the vector with XhoI and NaeI and gel purify the two bands before sequencing as the two CMV promoters and SV40-polyA sequences are very similar to each other Please visit https://www.biorxiv.org/content/10.1101/669127v1 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDmelOR-mRho.V5.mER.hOr47a was a gift from Bill Hansson (Addgene plasmid # 126478 ; http://n2t.net/addgene:126478 ; RRID:Addgene_126478) -
For your References section:
Optimization of Insect Odorant Receptor Trafficking and Functional Expression Via Transient Transfection in HEK293 Cells. Miazzi F, Hoyer C, Sachse S, Knaden M, Wicher D, Hansson BS, Lavista-Llanos S. Chem Senses. 2019 Oct 26;44(9):673-682. doi: 10.1093/chemse/bjz062. 10.1093/chemse/bjz062 PubMed 31504297