Skip to main content
Addgene

pTBL227 NheI-Cas9-KpnI-5xFlag-FseI-TdT-NotI
(Plasmid #126477)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 126477 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5523
  • Total vector size (bp) 11238
  • Modifications to backbone
    Switched neomycin resistance to hygromycin.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Cas9
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    4171
  • GenBank ID
  • Promoter CMV

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CMV Forward
  • 3′ sequencing primer ccggggtctcttcttccgagg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    5xFlag
  • Insert Size (bp)
    177
  • Mutation
    Changed codons to reduce repetitive sequences.
  • Promoter CMV

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site FseI (not destroyed)
  • 5′ sequencing primer GCAGCCTTCAAGTACTTCGACACC
  • 3′ sequencing primer ccggggtctcttcttccgagg
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    TdT
  • Alt name
    terminal deoxynucleotidyl transferase
  • Alt name
    DNA nucleotidylexotransferase
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1530
  • GenBank ID
    NM_004088.3
  • Entrez Gene
    DNTT (a.k.a. TDT)
  • Promoter CMV

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site FseI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GCAGCCTTCAAGTACTTCGACACC
  • 3′ sequencing primer BGH Reverse
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    George Church; Cas9 is from Addgene plasmid 41815.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/639120 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTBL227 NheI-Cas9-KpnI-5xFlag-FseI-TdT-NotI was a gift from Chang Liu (Addgene plasmid # 126477 ; http://n2t.net/addgene:126477 ; RRID:Addgene_126477)
  • For your References section:

    Lineage tracing and analog recording in mammalian cells by single-site DNA writing. Loveless TB, Grotts JH, Schechter MW, Forouzmand E, Carlson CK, Agahi BS, Liang G, Ficht M, Liu B, Xie X, Liu CC. Nat Chem Biol. 2021 Jun;17(6):739-747. doi: 10.1038/s41589-021-00769-8. Epub 2021 Mar 22. 10.1038/s41589-021-00769-8 PubMed 33753928