pDmelOR
(Plasmid #126476)

• Purpose: Vector for the functional expression of insect ORs in mammalian cells, with a human codon-optimized version of D.melanogaster Orco (hOrco) with an N-terminal myc tag and a β-globin/IgG chimeric intron
• Depositing Lab: Bill Hansson
• Publication: Miazzi et al Chem Senses. 2019 Oct 26;44(9):673-682. doi: 10.1093/chemse/bjz062.

Backbone

• Vector backbone: pCMV-BI
• Backbone size w/o insert (bp): 4111
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: DmelOrco
• Alt name: Orco
• Alt name: Odorant receptor co-receptor
• Species: D. melanogaster (fly)
• Insert Size (bp): 1509
• Mutation: codon optimization for H. sapiens; includes a recombinant β-globin/IgG chimeric intron to inhibit its functional expression in bacteria
• Entrez Gene: Orco (a.k.a. Dmel_CG10609, 83A.2, 83b, A45, CG10609, DOR45, DOR83b, DmORCO, DmOrco, DmelOrco, Dmel\CG10609, OR49, OR83B, OR83b, ORCO, Or83b, OrCo, or83b, orco, vainsA)
• Promoter: CMV
• Tag / Fusion Protein:
  • Myc (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: GTGTACGGTGGGAGGTCTATATAAG
• 3′ sequencing primer: GTGGTATGGCTGATTATGATCCTCT

Resource Information

• Supplemental Documents:
  • pDmelOR
  • Myc-hOrco(Intron)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Is it recommended to digest the vector with XhoI and PvuI-HF and gel purify the two bands before sequencing as the two CMV promoters and SV40-polyA sequences are very similar to each other. Use the EcoRI restriction site for best functional expression on the MCS2. Please visit https://www.biorxiv.org/content/10.1101/669127v1 for BioRxiv preprint