Skip to main content
Addgene

pCMV-BI
(Plasmid #126475)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 126475 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCMVTNT
  • Backbone manufacturer
    Promega
  • Backbone size (bp) 4111
  • Modifications to backbone
    The promoter, multiple cloning site and termination regions have been replaced with the bidirectional expression cassette of the pBI-CMV1 vector (Clontech)
  • Vector type
    Mammalian Expression
  • Promoter CMV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GGGGTCATTAGTTCATAGCCCATAT
  • 3′ sequencing primer CAAAACCGCATCACCATGGTAATAG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/669127v1 for BioRxiv preprint

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-BI was a gift from Bill Hansson (Addgene plasmid # 126475 ; http://n2t.net/addgene:126475 ; RRID:Addgene_126475)

  • For your References section:

    Optimization of Insect Odorant Receptor Trafficking and Functional Expression Via Transient Transfection in HEK293 Cells. Miazzi F, Hoyer C, Sachse S, Knaden M, Wicher D, Hansson BS, Lavista-Llanos S. Chem Senses. 2019 Oct 26;44(9):673-682. doi: 10.1093/chemse/bjz062. 10.1093/chemse/bjz062 PubMed 31504297
Related items:
Commonly requested with: