pAAV/L7-6-GFP-WPRE
(Plasmid #126462)

• Purpose: An AAV vector that expresses GFP under the control of the L7-6 promoter. The L7-6 promoter is the short size (0.8-kb) and has highly specificity to Purkinje cells.
• Depositing Lab: Hirokazu Hirai
• Publication: Nitta et al Mol Ther Methods Clin Dev. 2017 Jul 27;6:159-170. doi: 10.1016/j.omtm.2017.07.006. eCollection 2017 Sep 15.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 7914
• Total vector size (bp): 5758
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: L7-6, Purkinje cell specific promoter
• Alt name: pcp2 promoter
• Species: M. musculus (mouse)
• Insert Size (bp): 844

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: AgeI (not destroyed)
• 5′ sequencing primer: L7-6-rev, GGGGAGGGGGAGCAGATATC
• 3′ sequencing primer: GFP-rev, ACTTGTGGCCGTTTACGTCGC

Resource Information

• Supplemental Documents:
  • pAAV L7-6 GFP WPRE HBGpA.gb
• A portion of this plasmid was derived from a plasmid made by: The gene origin of L7-6 promoter is L7-4 promoter that is described in the paper (Nitta et al, 2017).
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the Addgene verified sequence contains a truncated ITR compared to the depositor's reference sequence. This truncation was present in the original stock and still worked well for AAV packaging.