pcDNA3.1(+) Laccase2 MCS-mFndc3b Mutant miRNAs
(Plasmid #126444)

• Purpose: Expresses a mutated version of mouse Fndc3b circular RNA with the miR-93-3p, miR-258-5p, and miR-412-3p target sites all mutated
• Depositing Lab: Jeremy Wilusz
• Publication: Garikipati et al Nat Commun. 2019 Sep 20;10(1):4317. doi: 10.1038/s41467-019-11777-7.

Backbone

• Vector backbone: pcDNA3.1(+) Laccase2 MCS Exon
• Total vector size (bp): 7399
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Fndc3b
• Species: M. musculus (mouse)
• Mutation: circFndc3b exons are separated by a miniature intron derived from the mouse Jmjd1c gene
• Entrez Gene: Fndc3b (a.k.a. 1600019O04Rik, AW550168, Fad104, mKIAA4164)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PacI (not destroyed)
• 3′ cloning site: SacII (not destroyed)
• 5′ sequencing primer: gatcctgatcaagaatatatatactttataccgcttcc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry