pTBL507 GA sgRNA
(Plasmid
#126434)
-
PurposeTo target a protospacer with GA at the cut site.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126434 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSQT1313
-
Backbone manufacturerKeith Joung
- Backbone size w/o insert (bp) 2259
- Total vector size (bp) 2280
-
Modifications to backboneThe backbone was modified to express only one sgRNA.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namespacer against human genome with GA at cut site
-
SpeciesH. sapiens (human)
-
Insert Size (bp)21
- Promoter human U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AGGGTTATTGTCTCATGAGCGG
- 3′ sequencing primer CGGACAGGTATCCGGTAAGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKeith Joung; the backbone was created from pSQT1313, Addgene #53370.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This construct was cloned by inverse PCR and in vivo recombination in E. coli strain SS320. Please visit https://doi.org/10.1101/639120 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTBL507 GA sgRNA was a gift from Chang Liu (Addgene plasmid # 126434 ; http://n2t.net/addgene:126434 ; RRID:Addgene_126434) -
For your References section:
Lineage tracing and analog recording in mammalian cells by single-site DNA writing. Loveless TB, Grotts JH, Schechter MW, Forouzmand E, Carlson CK, Agahi BS, Liang G, Ficht M, Liu B, Xie X, Liu CC. Nat Chem Biol. 2021 Jun;17(6):739-747. doi: 10.1038/s41589-021-00769-8. Epub 2021 Mar 22. 10.1038/s41589-021-00769-8 PubMed 33753928