-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 12613 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepB1H2
- Backbone size w/o insert (bp) 4093
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedorsal RHR in pB1H2
-
Alt namedorsal
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)887
-
GenBank IDCG6667
-
Entrez Genedl (a.k.a. Dmel_CG6667, CG6667, DL, Dl, Dmel\CG6667, Dor, Dorsal, GSd447, NF-KB, NF-kappaB, NFkappaB, anon-EST:GressD7, d, dL, fs(2)k10816, mat(2)dorsal, p65)
-
Tag
/ Fusion Protein
- flag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site AvrII (not destroyed)
- 5′ sequencing primer CGTGATGTACGTCAGCCTGAAG
- 3′ sequencing primer TTGTCGGCCTTTTTCTAGTCTCTAGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pB1H2 was a gift from Scot Wolfe (Addgene plasmid # 12613 ; http://n2t.net/addgene:12613 ; RRID:Addgene_12613) -
For your References section:
A bacterial one-hybrid system for determining the DNA-binding specificity of transcription factors. Meng X, Brodsky MH, Wolfe SA. Nat Biotechnol. 2005 Aug . 23(8):988-94. 10.1038/nbt1120 PubMed 16041365