-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 12612 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepB1H1
- Backbone size w/o insert (bp) 3527
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZif268 in pB1H1
-
Alt nameZif268
-
Alt nameEgr1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)304
-
GenBank IDEgr1
-
Entrez GeneEgr1 (a.k.a. A530045N19Rik, ETR103, Egr-1, Krox-1, Krox-24, Krox24, NGF1-A, NGFI-A, NGFIA, TIS8, Zenk, Zfp-6, Zif268, egr)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Not1 (not destroyed)
- 3′ cloning site AvrII (destroyed during cloning)
- 5′ sequencing primer GATTCGTCGTGCGGCAACCA
- 3′ sequencing primer GCGCTTCGTTAATACAGATG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pB1H1-Zif268 was a gift from Scot Wolfe (Addgene plasmid # 12612 ; http://n2t.net/addgene:12612 ; RRID:Addgene_12612) -
For your References section:
A bacterial one-hybrid system for determining the DNA-binding specificity of transcription factors. Meng X, Brodsky MH, Wolfe SA. Nat Biotechnol. 2005 Aug . 23(8):988-94. 10.1038/nbt1120 PubMed 16041365