pB1H1
(Plasmid #12611)

• Depositing Lab: Scot Wolfe
• Publication: Meng et al Nat Biotechnol. 2005 Aug . 23(8):988-94.

Backbone

• Vector backbone: pB1H1
• Backbone size w/o insert (bp): 3598
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Dorsal RHR in pB1H1
• Alt name: dorsal
• Species: D. melanogaster (fly)
• Insert Size (bp): 887
• GenBank ID: CG6667
• Entrez Gene: dl (a.k.a. Dmel_CG6667, CG6667, DL, Dl, Dmel\CG6667, Dor, Dorsal, GSd447, NF-KB, NF-kappaB, NFkappaB, anon-EST:GressD7, d, dL, fs(2)k10816, mat(2)dorsal, p65)
• Tag / Fusion Protein:
  • flag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: AvrII (not destroyed)
• 5′ sequencing primer: GATTCGTCGTGCGGCAACCA
• 3′ sequencing primer: GCGCTTCGTTAATACAGATG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry