pEVOL-ABK
(Plasmid #126035)

• Purpose: Efficient expression of tRNA synthetase/tRNA for the incorporation of a photo-cross-linker, 3’-azibutyl-N-carbamoyl-lysine (AbK) into recombinant protein by amber codon (TAG) suppression in E. coli.
• Depositing Lab: Andrea Musacchio
• Publication: Pan et al Nat Commun. 2019 Sep 6;10(1):4046. doi: 10.1038/s41467-019-12019-6.

Backbone

• Vector backbone: p15A
• Backbone size w/o insert (bp): 4200
• Total vector size (bp): 6801
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: BL21(DE3) strain can be used for the protein expression.
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: tRNA synthetase 1
• Species: M. barkeri
• Insert Size (bp): 1260
• Mutation: L274M, C313A, Y349F
• Promoter: araBAD promoter

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: ATGCCATAGCATTTTTATCC
• 3′ sequencing primer: GATTTAATCTGTATCAGG

Gene/Insert 2

• Gene/Insert name: tRNA synthetase 2
• Species: M. barkeri
• Insert Size (bp): 1260
• Mutation: L274M, C313A, Y349F
• Promoter: glnS promoter

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: PstI (not destroyed)
• 5′ sequencing primer: CGAGAGTAGGGAACTGCCAG
• 3′ sequencing primer: CGCTGAACGCGGCGTTTTGG

Gene/Insert 3

• Gene/Insert name: tRNA for TAG codon
• Species: Synthetic
• Insert Size (bp): 72
• Promoter: proK promoter

Cloning Information for Gene/Insert 3

• Cloning method: Unknown
• 5′ sequencing primer: not necessary
• 3′ sequencing primer: CAACAGTACTGCGATGAGTGGCAG

Resource Information

• Supplemental Documents:
  • pEVOL-ABK_Addgene.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry