Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEVOL-ABK
(Plasmid #126035)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 126035 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    p15A
  • Backbone size w/o insert (bp) 4200
  • Total vector size (bp) 6801
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    BL21(DE3) strain can be used for the protein expression.
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    tRNA synthetase 1
  • Species
    M. barkeri
  • Insert Size (bp)
    1260
  • Mutation
    L274M, C313A, Y349F
  • Promoter araBAD promoter

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    tRNA synthetase 2
  • Species
    M. barkeri
  • Insert Size (bp)
    1260
  • Mutation
    L274M, C313A, Y349F
  • Promoter glnS promoter

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer CGAGAGTAGGGAACTGCCAG
  • 3′ sequencing primer CGCTGAACGCGGCGTTTTGG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    tRNA for TAG codon
  • Species
    Synthetic
  • Insert Size (bp)
    72
  • Promoter proK promoter

Cloning Information for Gene/Insert 3

  • Cloning method Unknown
  • 5′ sequencing primer not necessary
  • 3′ sequencing primer CAACAGTACTGCGATGAGTGGCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEVOL-ABK was a gift from Andrea Musacchio (Addgene plasmid # 126035 ; http://n2t.net/addgene:126035 ; RRID:Addgene_126035)
  • For your References section:

    Mechanism of centromere recruitment of the CENP-A chaperone HJURP and its implications for centromere licensing. Pan D, Walstein K, Take A, Bier D, Kaiser N, Musacchio A. Nat Commun. 2019 Sep 6;10(1):4046. doi: 10.1038/s41467-019-12019-6. 10.1038/s41467-019-12019-6 PubMed 31492860