Skip to main content
Addgene

LEPG_shSik3.308
(Plasmid #125878)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 125878 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    LEPG #111160
  • Backbone size w/o insert (bp) 7900
  • Vector type
    Mammalian Expression, Retroviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shRNA targeting Sik3
  • gRNA/shRNA sequence
    TGCTGTTGACAGTGAGCGAAAGGTTGCTATTAAAATCATATAGTGAAGCCACAGATGTATATGATTTTAATAGCAACCTTGTGCCTACTGCCTCGGA
  • Species
    M. musculus (mouse)
  • Promoter MSCV-LTR

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer TGTTTGAATGAGGCTTCAGTAC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/636969v1 for BioRxiv preprint

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LEPG_shSik3.308 was a gift from Christopher Vakoc (Addgene plasmid # 125878 ; http://n2t.net/addgene:125878 ; RRID:Addgene_125878)

  • For your References section:

    Salt-Inducible Kinase inhibition suppresses acute myeloid leukemia progression in vivo. Tarumoto Y, Lin S, Wang J, Milazzo JP, Xu Y, Lu B, Yang Z, Wei Y, Polyanskaya S, Wunderlich M, Gray NS, Stegmaier K, Vakoc CR. Blood. 2019 Nov 1. pii: 422697. doi: 10.1182/blood.2019001576. 10.1182/blood.2019001576 PubMed 31697837
Related items:
Commonly requested with: