pEGFP-SUN1_888
(Plasmid
#125851)
-
PurposeExpresses SUN1_888 tagged with GFP in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 125851 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-N3
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 7400
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSUN1_888
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2661
-
GenBank IDAB648918
-
Entrez GeneSUN1 (a.k.a. UNC84A)
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bgl II (unknown if destroyed)
- 3′ cloning site Sal I (unknown if destroyed)
- 5′ sequencing primer AAATTAGATCTGCCACCATGGATTTTTCTCGGCTTCACATGTACAGT
- 3′ sequencing primer AAATTGTCGACCTTGACAGGTTCGCCATGAACTCTGAACCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-SUN1_888 was a gift from Miki Hieda (Addgene plasmid # 125851 ; http://n2t.net/addgene:125851 ; RRID:Addgene_125851) -
For your References section:
SUN1 splice variants, SUN1_888, SUN1_785, and predominant SUN1_916, variably function in directional cell migration. Nishioka Y, Imaizumi H, Imada J, Katahira J, Matsuura N, Hieda M. Nucleus. 2016 Nov;7(6):572-584. doi: 10.1080/19491034.2016.1260802. 10.1080/19491034.2016.1260802 PubMed 27858498