Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

lentiCRISPR v2-sgBAP1-2
(Plasmid #125838)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 125838 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    LentiCRISPR V2
  • Backbone manufacturer
    Feng Zhang
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BAP1 (BRCA1 associated protein 1)
  • gRNA/shRNA sequence
    CACCGTACCGAAATCTTCCACGAGC
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    25
  • Entrez Gene
    BAP1 (a.k.a. HUCEP-13, KURIS, TPDS1, UBM2, UCHL2, UVM2, hucep-6)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCRISPR v2-sgBAP1-2 was a gift from Boyi Gan (Addgene plasmid # 125838 ; http://n2t.net/addgene:125838 ; RRID:Addgene_125838)
  • For your References section:

    BAP1 links metabolic regulation of ferroptosis to tumour suppression. Zhang Y, Shi J, Liu X, Feng L, Gong Z, Koppula P, Sirohi K, Li X, Wei Y, Lee H, Zhuang L, Chen G, Xiao ZD, Hung MC, Chen J, Huang P, Li W, Gan B. Nat Cell Biol. 2018 Oct;20(10):1181-1192. doi: 10.1038/s41556-018-0178-0. Epub 2018 Sep 10. 10.1038/s41556-018-0178-0 PubMed 30202049