Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRSITEP-puro-shWRN1
(Plasmid #125783)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 125783 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRSITEP-puro
  • Backbone size w/o insert (bp) 8120
  • Vector type
    RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shWRN1
  • gRNA/shRNA sequence
    CAGCACTGCCAATGGTTCCAA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    66
  • Entrez Gene
    WRN (a.k.a. RECQ3, RECQL2, RECQL3)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/502070v1 for BioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSITEP-puro-shWRN1 was a gift from Francisca Vazquez (Addgene plasmid # 125783 ; http://n2t.net/addgene:125783 ; RRID:Addgene_125783)
  • For your References section:

    WRN helicase is a synthetic lethal target in microsatellite unstable cancers. Chan EM, Shibue T, McFarland JM, Gaeta B, Ghandi M, Dumont N, Gonzalez A, McPartlan JS, Li T, Zhang Y, Bin Liu J, Lazaro JB, Gu P, Piett CG, Apffel A, Ali SO, Deasy R, Keskula P, Ng RWS, Roberts EA, Reznichenko E, Leung L, Alimova M, Schenone M, Islam M, Maruvka YE, Liu Y, Roper J, Raghavan S, Giannakis M, Tseng YY, Nagel ZD, D'Andrea A, Root DE, Boehm JS, Getz G, Chang S, Golub TR, Tsherniak A, Vazquez F, Bass AJ. Nature. 2019 Apr 10. pii: 10.1038/s41586-019-1102-x. doi: 10.1038/s41586-019-1102-x. 10.1038/s41586-019-1102-x PubMed 30971823