pXPR_BRD003-sgPOLR2D
(Plasmid
#125769)
-
Purposeconstitutive expression of a guide RNA targeting human POLR2D (CRISPR positive control)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 125769 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepXPR_BRD003
- Backbone size w/o insert (bp) 8318
-
Vector typeCRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgPOLR2D
-
gRNA/shRNA sequenceAGAGACTGCTGAGGAGTCCA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)25
-
Entrez GenePOLR2D (a.k.a. HSRBP4, HSRPB4, RBP4, RPB16, RPB4)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/502070v1 for BioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXPR_BRD003-sgPOLR2D was a gift from Francisca Vazquez (Addgene plasmid # 125769 ; http://n2t.net/addgene:125769 ; RRID:Addgene_125769) -
For your References section:
WRN helicase is a synthetic lethal target in microsatellite unstable cancers. Chan EM, Shibue T, McFarland JM, Gaeta B, Ghandi M, Dumont N, Gonzalez A, McPartlan JS, Li T, Zhang Y, Bin Liu J, Lazaro JB, Gu P, Piett CG, Apffel A, Ali SO, Deasy R, Keskula P, Ng RWS, Roberts EA, Reznichenko E, Leung L, Alimova M, Schenone M, Islam M, Maruvka YE, Liu Y, Roper J, Raghavan S, Giannakis M, Tseng YY, Nagel ZD, D'Andrea A, Root DE, Boehm JS, Getz G, Chang S, Golub TR, Tsherniak A, Vazquez F, Bass AJ. Nature. 2019 Apr 10. pii: 10.1038/s41586-019-1102-x. doi: 10.1038/s41586-019-1102-x. 10.1038/s41586-019-1102-x PubMed 30971823