pCMV-RdLight1
(Plasmid #125706)

• Purpose: Expresses the red genetically encoded dopamine sensor RdLight1 in mammalian cells.
• Depositing Lab: Lin Tian
• Publication: Patriarchi et al Nat Methods. 2020 Nov;17(11):1147-1155. doi: 10.1038/s41592-020-0936-3. Epub 2020 Sep 7.

Backbone

• Vector backbone: pEGFP_N1
• Backbone size w/o insert (bp): 3983
• Total vector size (bp): 6032
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RdLight1
• Alt name: red dopamine sensor
• Species: Synthetic
• Insert Size (bp): 2049
• GenBank ID: MK751450
• Promoter: CMV
• Tag / Fusion Protein:
  • Flag tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ggcgtgtacggtgggaggtc
• 3′ sequencing primer: gctgcaataaacaagttaacaacaac

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry