AAV-EF1A-mScarlet-Gephyrin.FingR-IL2RGTC
(Plasmid #125695)

• Purpose: Global labeling of inhibitory synapses (red fluorescence)
• Depositing Lab: Xue Han
• Publication: Bensussen et al iScience. 2020 Jun 30;23(7):101330. doi: 10.1016/j.isci.2020.101330.

Backbone

• Vector backbone: AAV2
• Backbone size w/o insert (bp): 4589
• Total vector size (bp): 6963
• Modifications to backbone: Inserted IL2RGTC DNA binding sequence upstream of promoter. Changed to EF1A promoter.
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mScarlet-Gephyrin.FingR-IL2RGTC
• Insert Size (bp): 1575
• Promoter: EF1A

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC
• 3′ sequencing primer: CCAGTCAATCTTTCACAAAT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Part of this gene was derived from Addgene plasmids 46296 and 85044 deposited by Don Arnold and Dorus Gadella.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry